UNITED STATES
SECURITIES AND EXCHANGE COMMISSION
Washington, D.C. 20549
FORM
CURRENT REPORT
Pursuant to Section 13 or 15(d)
of the Securities Exchange Act of 1934
Date of Report (Date of earliest event reported):
(Exact name of registrant as specified in its charter)
| (State or other jurisdiction of incorporation) |
(Commission File Number) |
(I.R.S. Employer Identification No.) |
Prime Medicine, Inc.
| (Address of principal executive offices, including zip code) |
(Registrant’s telephone number, including area code)
Not Applicable
(Former Name or Former Address, if Changed Since Last Report)
Check the appropriate box below if the Form 8-K filing is intended to simultaneously satisfy the filing obligation of the registrant under any of the following provisions:
| Written communications pursuant to Rule 425 under the Securities Act (17 CFR 230.425) |
| Soliciting material pursuant to Rule 14a-12 under the Exchange Act (17 CFR 240.14a-12) |
| Pre-commencement communications pursuant to Rule 14d-2(b) under the Exchange Act (17 CFR 240.14d-2(b)) |
| Pre-commencement communications pursuant to Rule 13e-4(c) under the Exchange Act (17 CFR 240.13e-4(c)) |
Securities registered pursuant to Section 12(b) of the Act:
| Title of each class |
Trade Symbol(s) |
Name of each exchange on which registered | ||
Indicate by check mark whether the registrant is an emerging growth company as defined in Rule 405 of the Securities Act of 1933 (§ 230.405 of this chapter) or Rule 12b-2 of the Securities Exchange Act of 1934 (§ 240.12b-2 of this chapter).
Emerging growth company
If an emerging growth company, indicate by check mark if the registrant has elected not to use the extended transition period for complying with any new or revised financial accounting standards provided pursuant to Section 13(a) of the Exchange Act.
| Item 7.01 | Regulation FD Disclosure. |
Prime Medicine, Inc. (the “Company”) will be conducting meetings with participants attending the 41st Annual J.P. Morgan Healthcare Conference (the “Conference”) during the week of January 9, 2023. A copy of the slides to be presented by the Company at the Conference and a copy of the related press release are furnished as Exhibit 99.1 and Exhibit 99.2, respectively, to this Current Report on Form 8-K, which are incorporated herein by reference.
The information in this Item 7.01, including Exhibit 99.1 and Exhibit 99.2 attached hereto, is intended to be furnished and shall not be deemed “filed” for purposes of Section 18 of the Securities Exchange Act of 1934, as amended (the “Exchange Act”), or otherwise subject to the liabilities of that section, nor shall it be deemed incorporated by reference in any filing under the Securities Act of 1933, as amended, or the Exchange Act, except as expressly set forth by specific reference in such filing.
| Item 9.01. | Financial Statements and Exhibits. |
(d) Exhibits
| 99.1 | Presentation at 41st Annual J.P. Morgan Healthcare Conference, dated January 2023, furnished herewith. | |
| 99.2 | Press Release, dated January 9, 2023, furnished herewith. | |
| 104 | Cover Page Interactive Data File | |
SIGNATURE
Pursuant to the requirements of the Securities Exchange Act of 1934, the registrant has duly caused this report to be signed on its behalf by the undersigned hereunto duly authorized.
| Prime Medicine, Inc. | ||||||
| Date: January 9, 2023 | By: | /s/ Keith Gottesdiener | ||||
| Keith Gottesdiener | ||||||
| President and Chief Executive Officer | ||||||
Exhibit 99.1 Prime Medicine st 41 Annual J.P. Morgan Healthcare Conference January 2023 1
Forward-Looking Statements This presentation contains forward-looking statements of Prime Medicine, Inc. (“Prime”, “we” or “our”) within the meaning of the Private Securities Litigation Reform Act of 1995. These forward-looking statements contain information about our current and future prospects and our operations and financial results, which are based on currently available information. All statements other than statements of historical facts contained in this presentation, including statements regarding our strategy, future financial condition, future operations, projected costs, prospects, plans, objectives of management and expected market growth, are forward-looking statements. In some cases, you can identify forward-looking statements by terminology such as ‘‘aim,’’ ‘‘anticipate,’’ ‘‘assume,’’ ‘‘believe,’’ ‘‘contemplate,’’ ‘‘continue,’’ ‘‘could,’’ ‘‘design,’’ ‘‘due,’’ ‘‘estimate,’’ ‘‘expect,’’ ‘‘goal,’’ ‘‘intend,’’ ‘‘may,’’ ‘‘objective,’’ “opportunity,” ‘‘plan,’’ ‘‘predict,’’ ‘‘positioned,’’ ‘‘potential,’’ ‘‘seek,’’ ‘‘should,’’ ‘‘target,’’ ‘‘will,’’ ‘‘would’’ and other similar expressions that are predictions of or indicate future events and future trends, or the negative of these terms or other comparable terminology. These forward-looking statements include, but are not limited to, express or implied statements about Prime’s beliefs and expectations regarding: the initiation, timing, progress and results of our research and development programs, preclinical studies and future clinical trials; our ability to demonstrate, and the timing of, preclinical proof-of-concept in vivo for multiple programs; our ability to advance any product candidates that we may identify and successfully complete any clinical studies, including the manufacture of any such product candidates; our ability to pursue our four strategic indication categories: immediate target indications, differentiation target indications, “blue sky” indications and “march up the chromosome” approaches; our ability to quickly leverage programs within our initial target indications and to progress additional programs to further develop our pipeline; the timing of our regulatory filings, including our investigational new drug applications submissions; the implementation of our strategic plans for our business, programs and technology; the scope of protection we are able to establish and maintain for intellectual property rights covering our Prime Editing technology; developments related to our competitors and our industry; our ability to leverage the clinical, regulatory, and manufacturing advancements made by gene therapy and gene editing programs to accelerate our clinical trials and approval of product candidates; our ability to identify and enter into future license agreements and collaborations; developments related to our Prime Editing technology; regulatory developments in the United States and foreign countries; our ability to attract and retain key scientific and management personnel; our estimates of our expenses, capital requirements, and needs for additional financing as well as our cash runway into 2025; and general economic, industry and market conditions, including rising interest rates and inflation. Actual results or events could differ materially from the plans, intentions and expectations disclosed in the forward-looking statements we make due to a number of risks and uncertainties. These and other risks, uncertainties and important factors are described in the section entitled Risk Factors in our most recent Quarterly Report on Form 10-Q, as well as any subsequent filings with the Securities and Exchange Commission. Any forward-looking statements represent our views only as of the date of this presentation and we undertake no obligation to update or revise any forward-looking statements, whether as a result of new information, the occurrence of certain events or otherwise. We may not actually achieve the plans, intentions or expectations disclosed in our forward-looking statements, and you should not place undue reliance on our forward-looking statements. No representations or warranties (expressed or implied) are made about the accuracy of any such forward-looking statements. Certain information contained in this presentation relates to or is based on studies, publications, surveys and other data obtained from third-party sources and our own internal estimates and research. While we believe these third-party studies, publications, surveys and other data to be reliable as of the date of this presentation, we have not independently verified, and make no representation as to the adequacy, fairness, accuracy or completeness of, any information obtained from third-party sources. In addition, no independent source has evaluated the reasonableness or accuracy of our internal estimates or research and no reliance should be made on any information or statements made in this presentation relating to or based on such internal estimates and research. 2
30 years after the first patient was treated with gene therapy, gene editing is only just beginning to demonstrate clinical benefit. Now is the moment for a revolution. Prime Medicine brings together the right people and the right technology at the right time with the aim to deliver the promise of one-time, curative genetic therapies to address the widest spectrum of diseases. 3
Delivering the full promise of gene editing requires an extremely powerful technology Prime Editing (PE) stands out as a best-in-class genetic medicine approach Versatility: only gene editing technology with the capability to edit, correct, insert, and delete ✓ Performs and corrects insertions, deletions, and all twelve types of single base pair corrections ✓ Precisely targets to insert or delete kilobase-sized DNA ✓ Easily programmable to a unique target location and for a broad set of edits ✓ Restores gene function for multiple mutations with a single product (i.e., “hotspots”) Precision: May be much safer with minimal, or no, off-target editing ✓ Does not create double stranded breaks: high specificity with low indels rate at targeted editing site ✓ Does not create double stranded breaks: minimal or no off-target activity ✓ Limited potential for “bystander editing” at target site Efficiency: Durable and high-efficiency editing demonstrated across Prime Medicine portfolio ✓ Permanent edits that are passed along to daughter cells ✓ Corrects genes in situ, maintaining native gene control ✓ Single-dose, potentially curative correction to wild-type sequence Breadth: Able to address ~90% of disease-causing mutations in multiple tissue types and cells ✓ Corrects mutations in dividing and non-dividing human cells ✓ 100’s of potential indications already available in Prime Editing’s toolbox 4
Delivering the full promise of gene editing requires an extremely powerful technology Prime Editing (PE) stands out as a best-in-class genetic medicine approach Versatility: only gene editing technology with the capability to edit, correct, insert, and delete ✓ Performs and corrects insertions, deletions, and all twelve types of single base pair corrections ✓ Precisely targets to insert or delete kilobase-sized DNA ✓ Easily programmable to a unique target location and for a broad set of edits ✓ Restores gene function for multiple mutations with a single product (i.e., “hotspots”) Precision: May be much safer with minimal, or no, off-target editing ✓ Does not create double stranded breaks: high specificity with low indels rate at targeted editing site ✓ Does not create double stranded breaks: minimal or no off-target activity ✓ Limited potential for “bystander editing” at target site Efficiency: Durable and high-efficiency editing demonstrated across Prime Medicine portfolio ✓ Permanent edits that are passed along to daughter cells ✓ Corrects genes in situ, maintaining native gene control ✓ Single-dose, potentially curative correction to wild-type sequence Breadth: Able to address ~90% of disease-causing mutations in multiple tissue types and cells ✓ Corrects mutations in dividing and non-dividing human cells ✓ 100’s of potential indications already available in Prime Editing’s toolbox 5
Prime Medicine is well-positioned to maximize Prime Editing’s broad therapeutic potential In ~2.5 years since company inception: Identified and progressed initial pipeline of 18 programs • Focusing on indications with the fastest, most direct path to demonstrating technological success, as well as diseases that cannot be treated using other gene-editing approaches • In vivo studies in progress across portfolio; multiple programs advancing toward development candidates, with first IND filing potentially as early as 2024 Demonstrated Prime Editing capabilities: established preclinical proof-of-concept and safety • In vivo long-term engraftment of Prime Edited hematopoietic stem cell therapy for Chronic Granulomatous Disease Built and • Efficient removal of pathological repeats in Friedrich’s Ataxia, a Repeat Expansion Disease, with phenotypic correction in patient organoids advanced a • Efficient editing with phenotypic correction of cystic fibrosis patient organoids strategic portfolio Advanced CMC and delivery capabilities • Efficient in vivo Prime Editing in rodent liver and central nervous system Optimized and expanded Prime Editing platform, capabilities and IP • One-step non-viral precise insertion of whole genes into the genome in primary human cells using PASSIGE technology • Industrialized and automated Prime Editor screening capabilities • Advanced and substantially improved Prime Editing • Developed strong Intellectual Property position Led by world-class, diverse team of researchers and drug developers; grew company to ~200 employees Established Raised ~$315M in Series A/B, and ~$200M in IPO (Oct ‘22), from a blue-chip group of investors strong corporate Leveraging close relationship with founders David Liu and Andrew Anzalone to bring new innovation rapidly into Prime Medicine position Aim to create additional value and extend reach through BD and partnering in 2023 6
Our current portfolio of 18 programs leverages the versatility and breadth of Prime Editing To be discussed in detail today STRATEGIC TARGET INDICATION DELIVERY DISCOVERY* IND-ENABLING CLINICAL TRIALS CATEGORY TISSUE Sickle Cell Disease ex vivo BLOOD Chronic Granulomatous Disease ex vivo Fanconi Anemia ex vivo Wilson’s Disease LNP LIVER Glycogen Storage Disease 1b LNP IMMEDIATE Retinitis Pigmentosa/Rhodopsin AAV EYE Retinitis Pigmentosa/Usher Syndrome AAV Usher Syndrome Type 3 AAV EAR Non-Syndromic Hearing Loss – GJB2 AAV Friedreich’s Ataxia viral/non-viral Myotonic Dystrophy Type 1 viral/non-viral Amyotrophic Lateral Sclerosis viral/non-viral NEURO- DIFFERENTIATION: MUSCULAR Oculopharyngeal Muscular Dystrophy LNP REPEAT EXPANSION DISEASES Fragile X Syndrome viral/non-viral Huntington’s Disease TBD EYE Fuchs’ Endothelial Corneal Dystrophy viral/non-viral MUSCLE Duchenne Muscular Dystrophy AAV DIFFERENTIATION: OTHER LUNG Cystic Fibrosis LNP Initially focused on our first two strategic indication categories in diseases where Prime Editing could offer compelling advantages over current standard-of-care and novel therapeutic modalities in development AAV = adeno-associated viral vectors; LNP = lipid nanoparticles; TBD = to be determined 7 *As of IPO pricing, 10/19/22
Ex-Vivo HSC Successful Prime Editing in long-term HSC population: in vivo engraftment in Chronic Granulomatous Disease mouse model Maintenance of >92% corrected long-term HSCs following 16-week engraftment + + Prime Editor Naive CD34 Edited CD34 NBSGW mice Cryopreserve/Thaw 0hr 24hr 0 weeks 16 weeks Editing performed by electroporation + No difference in engraftment for PE Long-term engrafted CD34 HSCs Edited HSCs vs controls carry precise correction of NCF1 Conclusions 100 100 ✓ High efficiency, very precise editing of HSCs 80 80 ✓ High-level, long-term engraftment resulting in 60 60 healthy Prime Edited long-term HSCs ✓ Restores key myeloid function to fight infection 40 40 ✓ Generate all lineages without skewing Minimum 20 20 ✓ Mice are healthy at 16 weeks, no toxicity threshold for patient benefit ✓ Recapitulates the expected clinical study design 0 0 Mock Prime Unedited Prime Edited Edited W41J + scid tm1Wjl + NBSGW: NOD.Cg-Kit Tyr Prkdc Il2rg /ThomJ highly immunodeficient mice that support human CD34 cell engraftment without irradiation. HSC: hematopoietic stem cell. PE: Prime Edited. 8 Bone Marrow Chimerism (% human CD45+) Cells corrected (%)
Methylation (%) Repeat Expansion Diseases Successful Prime Editing removal of pathogenic repeats: Friedreich’s ataxia High efficiency Prime Editing removes the GAA pathological repeats and hyper-methylation at the Frataxin Dual-flap correction of FXN in FRDA iPSCs (FXN) gene in Friedreich’s Ataxia patients Hyper-methylation prevents Demethylation by Prime Editing restores 100 Expanded Repeat mRNA transcription of FXN mRNA transcription of FXN 5 active prime editors negative controls Dual-flap Prime Editing Prime loops out expanded repeat Editing X 80 Promoter Exon 1 Intron 1 Promoter Exon 1 Intron 1 Repeats Prime Edited 60 1 Removal of Hyper-Methylation 40 80 Healthy 20 60 Patient 0 40 FRDA iPSCs* 20 Patient ✓ High efficiency, very precise editing of patient cells Prime Edited without double strand breaks 0 -327 -239 -236 427 431 460 466 477 506 ✓ Restores normal methylation of FXN gene Promoter Intron 1 Many repeat expansion diseases exhibit hyper-methylation as a key feature of the underlying pathogenesis 9 FXN: frataxin gene: FRDA: Friedreich’s ataxia; iPSCs: induced pluripotent stem cells. 1 Methylation quantified by bisulfite sequencing % precise correction % precise correction
Repeat Expansion Diseases Successful Prime Editing removal of pathogenic repeats High efficiency Prime Editing restores FXN protein expression and sensory neuron function in Friedreich’s Ataxia patients’ dorsal root ganglia Restoration of axonal βIII-TUB projections after prime editing Restoration of Frataxin protein DAPI expression after Prime Editing Frataxin (mature) 12 kDa 40 kDa GAPDH Control FRDA patient iPSCs Healthy Donor FRDA Patient FRDA Patient Prime-Edited 10 FXN: Frataxin; FRDA: Friedreich's Ataxia; iDRG: iPSC-derived dorsal root ganglia. DAPI: nuclear staining; βIII-TUB: axonal projection staining
Unmet need in CF Unmet needs in Cystic Fibrosis: Restoring CFTR function in patients with G542X mutation One-time, non-viral delivery to patient intestinal organoids restores CFTR function Optimization results in high efficiency Prime Prime Editing of patient intestinal organoids Editors that precisely correct G542X restores swelling and CFTR function mutation Intestinal organoids swelling assay for CFTR function Healthy control G542X with mock treatment 1 2 3 4 5 Prime Editing G542X with G542X with Prime Optimizations TRIKAFTA® treatment Editing correction 11 Van Mourik et al., 2019. Actual time course: 24 hours. TRIKAFTA® is a registered trademark of Vertex Pharmaceuticals, Incorporated. % precise correction
Off-Target Safety: Prime’s comprehensive suite of assays for off- target discovery* GGCCCAG-CTGAGCTCGTGA Local off-targets Chromosome scale or structural off-targets Off-target PE2 GGCCCAGACTGAGCACGTGA Translocations PE2 cDNA synthesis genome On-target Large Deletions Reverse Trans. Assay Chromosomal Integrity Assays Targeted Nick Genome wide Genome wide Nick ** ** Detection Assay DSB detection Detection Assay mRNAseq Imaging Sequencing based PEG integration potential off-target editing sites Whole Genome Vector Integration Sequencing Analysis Targeted Sequencing (>1000x) Identified Identified Off-targets Off-targets * ** 12 Preliminary plans pending discussions with regulatory agencies; Proprietary assay developed by Prime
Off-Target Safety: Preliminary off-target analyses demonstrate minimal or no off-target editing Data expands the demonstration of no off-target editing detected across multiple prime edited cell types Wilsons Disease 1 CGD Program: CD34+ Cells Genome wide and 2 Program: Hepatocytes targeted detection of potential off- targets On-target (ATP7B) On-target (NCF1) potential off- target editing sites Targeted Sequencing 0.5% threshold Identified off-targets 1 2 13 Analysis of edited CD34+ cells from CGD program: Targeted Analysis of 550 potential off-target sites of off-target editing. Analysis of edited iHEP (iPSG hepatocyte) cells from the Wilsons Disease program: Targeted Analysis of 170 potential off-target sites. SNP: Single nucleotide polymorphisms
LNP Delivery LNP Delivery: Optimization of mRNA increases Prime Editing efficiency and leads to reduction of PCSK9 protein in serum Prime Editor LNP delivered to the liver a precisely introduced stop codon in PCSK9 gene in mice Prime Editor LNP delivered systemically • Prime Editor mRNA • Prime editor guide RNA Day 0 Day 7 Optimized mRNA Optimized mRNA decreases PCSK9 protein increases Prime Editing 0 50 -20 40 -40 30 -60 20 -80 10 -100 0 mRNA lot # mRNA lot # Saline 1 2 3 Saline 1 2 3 14 LNP delivery to mice results in 42% PCSK9 Prime Editing and 92% serum protein reduction Precise Editing (%) Protein Reduction (%)
Dual AAV Delivery Prime Editing Delivery: CSF and Local Administration to CNS via dual AAV achieves high efficiency in mouse brain 2 Dual AAV effectively delivers to ~ 95%, and precisely edits ~80%, of neurons in adult mice Prime Editor dual AAV • Prime Editor • Prime editor dual guide RNA 1 0 weeks 3-5 weeks 1 1 Neonatal mice – ICV infusion Adult mice – local administration transduced cortex (left) and precisely transduced neurons (left) and precisely edited cortical cells (right) 2 edited neurons (right) Isolate Isolate transduced transduced cells neurons Measure editing Measure editing Transduced Prime Edited Transduced Prime Edited 1 2 15 Three weeks in neonatal mice via intra-cerebral infusion (ICV); 5 weeks in adult mice via local administration into cerebellum or cortex. Prime Editor cassette with neuron-specific promoter. All experiments shown are Proof of Concept delivery experiments using a control Prime Editor site. % of cells transduced % precise correction % of neurons transduced % precise correction in neurons
Prime Medicine has rapidly advanced and substantially improved Prime Editing • Prime Medicine holds foundational IP and has filed for IP protection for technological advancements • Patent portfolio includes U.S. Patent 11,447,770 covering methods of using Prime Editors, and US allowed application 17/219,635 covering pegRNAs (expected to issue Q1 2023) 1 3 Seminal Prime Editing Publication PASSIGE System PE4, PE5, and PEmax Novel PE Proteins • All base pair edits, insertions of 40+ bp, • Advanced PE+ recombinase approach• Up to 7-fold increase in editing• 80+ active RT domains deletions of 80+ bp• Targeted whole gene insertions with up to • Up to 2-fold decrease in byproducts• RT domains up to 60% smaller • Efficiencies ranging from ~10%-60% 60% efficiency• Up to 2-fold increase in editing • Targeted introduction of recombinase site 2 4 pegRNA Enhancements Dual Flap Prime Editing Engineered pegRNAs • New classes of efficiency-increasing • Efficiencies ≥80%• Improved pegRNA stability pegRNAs enhancements • Hotspot editing and larger insertions• Up to 4-fold increase in editing • Synergies with recombinase enzymes (>5-kb targeted DNA integration) 16 : 1 2 3 4 Peer reviewed publications Anzalone, et al, Nature 2019. Anzalone, et al, Nat. Biotechnol. 2021. Chen, et al, Cell 2021. Nelson, et al, Nat. Biotechnol. 2021.
PASSIGE Prime Assisted Site-Specific Integrase Gene Editing PASSIGE: Applying Prime Editing to insert gene sized sequences precisely in the genome Programmed insertion of Integration of Precise target recombinase location in DNA at precise DNA target genomic DNA location sequence Site-specific Prime Editing recombination Genomic DNA Genomic DNA Gene-sized DNA with recombinase (purple) inserted at DNA donor target sequence precise location in (pink) the genome Recombinase enzyme One step non-viral kilobase-size gene editing approach – without double stranded breaks 17
PASSIGE PASSIGE: Efficient insertion of gene-sized sequence into a single targeted genomic site in human primary T cells PASSIGE one-step non-viral approach for precise introduction of gene sized cargo into the genome Single targeted genomic locus Prime Editing to insert recombinase …. attachment site Genetic cargo 3.5kb Recombinase to integrate genetic cargo Gene of interest …. Insertion of recombinase Integration of genetic cargo at single Phenotypic impact from newly site - over 90% efficiency targeted site in 60% of T cells inserted gene of interest 100 100 100 *** **** 100 **** 80 80 80 80 60 60 60 GFP+ T cells 60 Control T cells 40 40 40 CD19-CAR/GFP+ T cells PASSIGE T cells 40 20 20 20 20 0 0 0 0 Recombinase Recombinase - + - - ++ - + 1:3 1:1 3:1 - + 3.5 kb gene of interest Prime Editor GFP CD1G 9-F C P AR GFP CD19-CAR GFP Cell dose Effector : Target Cell Ratio The targeted inserted gene of interest provides a potent new cell function 18 PASSIGE: Prime-Assisted Site-Specific Integrase Gene Editing; n = 2 technical replicates ; Far right panel: n = 4 technical replicates; Two-way ANOVA with Bonferroni post-test *** P = 0.0002; **** P < 0.0001 % CD3 loss % precise insertion % Positive % Positive Phenotypic % Viable response CD19+ Tumor Cells
Business Development Business Development and Partnering: A major focus for 2023 We aim to maximize PE’s broad therapeutic potential and create value by: 1 2 3 Entering strategic collaborations Independently developing and Partnering and licensing to to extend the reach and commercializing in appropriate access enabling technologies, impact of PE, provide disease areas (our pipeline) including delivery, manufacturing funding, and create value in and technologies synergistic with areas we may not enter Prime Medicine products ourselves in the near-term but may enter later This strategy aims to fully exploit the richness of our potential to create programs and address indications, while focusing our internal resources on what we do best, ultimately accelerating our efforts to translate PE into new medicines for patients worldwide. 19 PE = Prime Editing
Building the Company Currently • 184+ employees; approximately 85% across Research & Technical Development • Key leadership and staff across all departments of the organization in place • Built out core capabilities across the company, from IP strategy to automation and AI to RNA technologies • Established strong external relationships • 3 locations in Cambridge, MA and a chemistry facility in Watertown, MA, with buildout of 150,000 square feet permanent space in an additional Cambridge facility, target for move 2024 • Successful IPO in Oct 2022, with >$500M raised to date Critical Milestones Achieved Successful Growth of Talent 184+ October 2019 July 2020 September 2019 April 2021 Oct 2022 Prime Editing Commenced 1 seminal Nature Corporate $115M Series A $200M Series B ~$200M IPO paper Operations 90 45 4 Dec 2022 July 2020 July 2021 Dec 2021 July 2022 20 1 Anzalone et al., Nature, 2019
Key upcoming events will continue to drive the Prime Medicine platform forward Summary of select ongoing activities and next steps for Prime Medicine • Nominate first Development Candidate for Chronic Granulomatous Disease (CGD) in 1Q 2023. • Initiate investigational new drug (IND)-enabling studies in CGD in 2023. • Expand preclinical proof-of-concept in vivo, including sharing data from in vivo rodent studies and large Pipeline animal studies in several programs in 2H 2023. • Share in vitro preclinical data in additional liver, eye and neuromuscular programs. • First IND filing expected as early as 2024 and additional IND filings anticipated in 2025. • Continue to develop and optimize non-viral and viral delivery systems and share additional proof-of-concept data from in vivo rodent and large animal studies in 2H 2023. Platform • Further demonstrate superior “off-target” profile for Prime Editing programs. • Extend Prime Editing using proprietary recombinase and/or retrotransposon technologies for new and existing programs. Strong cash position: Cash, cash equivalents and short-term investments as of 9/30/2022, together with approximately gross $200M raised in October IPO, sufficient to fund anticipated operating expenses and capital expenditure requirements into 2025. 21
Prime Medicine January 2023 22
Exhibit 99.2
Prime Medicine Announces Recent Progress and Highlights 2023 Strategic Priorities
— New preclinical data in Friedrich’s ataxia and cystic fibrosis provided further proof-of-concept for Prime Editing’s ability to achieve restoration of genetic function —
— New preliminary safety analyses demonstrated no detected off-target activity in Prime Edited Wilson’s disease cells —
— New data leveraging PASSIGE technology demonstrated ability to integrate kilobase-sized DNA in human T cells —
— Additional LNP and AAV delivery data demonstrated efficient in vivo delivery of Prime Editing to various target tissues in rodents —
— Multiple catalysts expected in 2023, including first development candidate nomination in 1Q and additional in vivo data in 2H —
— Strong corporate position, with robust intellectual property position and cash to fund operations into 2025 —
Cambridge, Mass., Jan. 9, 2023 – Prime Medicine, Inc. (Nasdaq: PRME), a biotechnology company committed to delivering a new class of differentiated one-time curative genetic therapies, today provided an update on recent advancements of its Prime Editing technology and progress across its initial pipeline of eighteen programs, and outlined its strategic priorities and expected milestones for 2023.
“Since our inception, we have focused on building the necessary foundation to maximize Prime Editing’s therapeutic potential, identifying and progressing a diverse initial pipeline, introducing optimizations to extend the reach of our Prime Editing technology, and investing in the CMC and delivery capabilities that will ultimately be required to deliver our investigational therapies to patients,” said Keith Gottesdiener, M.D., President and Chief Executive Officer of Prime Medicine. “Today, we are pleased to announce accomplishments across our portfolio and platform, including new preclinical proof-of-concept data in Friedrich’s ataxia and cystic fibrosis showing restoration of genetic function; new safety analyses detecting no off-target editing in Prime Edited Wilson’s disease cells; the first presentation of our ability to use PASSIGE technology to precisely insert a whole gene into human T cells; and further optimization of our lipid nanoparticle and adeno-associated virus delivery platforms. Together, these updates reinforce our belief in Prime Editing as an extremely powerful, differentiated technology, with the potential to deliver one-time, curative genetic therapies to address a wide spectrum of diseases. As we enter 2023, we look forward to progressing our most advanced programs toward the clinic, while continuing to optimize our technology and build the internal organization, culture and expertise necessary to meet our ambitious goals.”
Recent Business Updates
Pipeline
Prime Medicine is advancing a strategic pipeline of eighteen programs. The company is initially focused on indications with the opportunity for the fastest, most direct path to the clinic and technical success in humans, as well as indications that cannot be treated using other gene editing approaches. In vivo studies are progressing across Prime Medicine’s portfolio and, in recent months, the company has established preclinical proof-of-concept and expanded safety data in a variety of target tissues and indications. Today, Prime Medicine is announcing new preclinical data for several programs:
| • | Friedrich’s Ataxia (FRDA), a multisystem, autosomal recessive neurodegenerative disorder affecting the central and peripheral nervous systems, as well as the heart and other organs. FRDA is caused by GAA-repeat nucleotide sequence expansions in intron 1 of the FXN gene encoding the frataxin protein, which plays important roles in mitochondria. In preclinical studies, Prime Medicine is using its technology to precisely remove the GAA pathological repeats at the FXN gene, restoring Frataxin protein expression and sensory neuron function in patient dorsal root ganglia. |
| • | Today, Prime Medicine announced new preclinical data demonstrating that Prime Editing-mediated removal of pathological repeats in vitro results in correction of hypermethylation at the FXN gene, restoring genetic function back to wild-type levels. The company believes these data also support the evaluation of Prime Editing for the potential treatment of other repeat expansion diseases, many of which exhibit hypermethylation as a key feature of the underlying pathogenesis. |
| • | Cystic Fibrosis (CF), a progressive lung disease characterized by the production of thick mucus lung secretions, which block patients’ airways, leading to inflammation, lung infection and, ultimately, lung failure. CF is caused by loss of function mutations in the CFTR gene, which reduces chloride and bicarbonate transport to the epithelial lumen, resulting in thickened secretions, blocked ducts and bronchioles and secondary infections. F508del and mutations at seven additional hotspots, including G542X, are found in 98 percent of patients. |
| • | Today, Prime Medicine shared initial preclinical data showing greater than 70 percent precise editing of the G542X mutational hotspot in vitro, as well as functional restoration of swelling and CFTR function in patient-derived intestinal organoids. The G542X mutation is not addressed by currently marketed therapies. The company believes these data demonstrate that precise genetic correction by Prime Editing has the potential to achieve complete phenotypic rescue. |
| • | Off-target Safety Data: Prime Medicine is progressing a comprehensive suite of assays to evaluate the potential off-target activity of its Prime Editors. Because it does not create double-stranded breaks and requires three “edit checks,” or places where there must be a match between the editor and target DNA in order to complete an edit, Prime Editing occurs with high specificity, low indel rates and minimal to no off-target activity, resulting in potentially greatly improved safety and tolerability. Today, Prime Medicine shared preclinical safety analyses from two programs – new data in Wilson’s disease (WD) and an incremental update on previously reported data in Chronic Granulomatous Disease (CGD) – which together further support Prime Editing as a highly specific and predictable gene editing tool. |
| • | In WD, a devastating rare disease of the liver, Prime Medicine announced the results of a preliminary off-target analysis in induced pluripotent stem cell (iPSC)-derived hepatocytes, which detected no guide-dependent Prime Editing activity across 170 identified potential off-target sites. |
| • | In CGD, a rare disease that causes recurrent, debilitating infections in children, Prime Medicine shared the results of a preliminary off-target analysis in CD34+ cells, which detected no guide-dependent Prime Editing activity across 550 identified potential off-target sites. |
Prime Editing Platform
Since it was first described in 2019, Prime Medicine’s platform team has continued to optimize its PASSIGE (Prime Assisted Site-Specific Integrase Gene Editing) technology. PASSIGE combines Prime Editing with an integrase or site-specific recombinase enzyme to enable the introduction of large-sized cargo into the genome as a potential one-time therapy. This approach further increases the versatility of Prime Editing and broadens the range of permanent genomic edits that Prime Editing can make to potentially treat disease, including the ability to insert, delete or invert gene-sized pieces of DNA.
| • | Today, Prime Medicine announced new preclinical data utilizing PASSIGE in a one-step, non-viral process, which resulted in an approximately 60 percent precise insertion of a 3.5 kilobase transgene at a single targeted site in primary human T cells. |
CMC and Delivery
Prime Medicine is investing in internal chemistry, manufacturing, and controls (CMC) development and delivery capabilities in order to build the foundational competencies necessary to deliver its pipeline programs to patients as the company prepares to enter the clinic. In recent months, Prime Medicine has continued to advance its lipid nanoparticle (LNP) and adeno-associated virus (AAV) delivery platforms, demonstrating and disclosing for the first time today:
| • | Additional proof-of-concept data for LNP delivery of Prime Editors to rodent liver, including the first in vivo demonstration of the introduction of a precisely edited stop codon in the PCSK9 gene, resulting in greater than 40 percent editing and greater than 90 percent reduction in serum PCSK9 protein. Prime Medicine is using PCSK9 as a model system for developing its modular LNP delivery platform to the liver. |
| • | New data demonstrating that dual AAV delivery to the central nervous system achieves high efficiency transduction in murine models, with a high level of precise editing in transduced cells. Specifically, using intracerebroventricular delivery, Prime Editing precisely edited approximately 90 percent of transduced cortical cells and, utilizing local administration, Prime Editing precisely edited approximately 80 percent of transduced neurons. |
Anticipated Upcoming Milestones
Prime Medicine expects the following activities and next steps to drive the Prime Editing platform forward:
Pipeline
| • | Nominate first development candidate for CGD in 1Q 2023. |
| • | Initiate investigational new drug (IND)-enabling studies in CGD in 2023. |
| • | Expand preclinical proof-of-concept in vivo, including sharing data from in vivo rodent studies and large animal studies in several programs in 2H 2023. |
| • | Share in vitro preclinical data in additional liver, eye and neuromuscular programs. |
| • | First IND filing expected as early as 2024 and additional IND filings anticipated in 2025. |
Platform
| • | Continue to develop and optimize non-viral and viral delivery systems and share additional proof-of-concept data from in vivo rodent and large animal studies in 2H 2023. |
| • | Further demonstrate superior “off-target” profiles for Prime Editing programs. |
| • | Expand Prime Editing using proprietary recombinase and/or retrotransposon technologies for new and existing programs. |
Financial Guidance
Based on its current operating plans, Prime Medicine expects that its cash, cash equivalents and short-term investments as of September 30, 2022, together with the approximately $200 million in gross proceeds raised through its initial public offering in October 2022, will be sufficient to fund its anticipated operating expenses and capital expenditure requirements into 2025.
About Prime Medicine
Prime Medicine is a biotechnology company committed to delivering a new class of differentiated, one-time, curative genetic therapies to address the widest spectrum of diseases. The company is deploying Prime Editing technology, a versatile, precise, efficient and broad gene editing technology, which is designed to make only the right edit at the right position within a gene. With the potential to repair approximately 90 percent of known disease-causing genetic mutations across many organs and cell types, medicines based on Prime Editing could offer a one-time curative genetic therapeutic option to a broad set of patients.
Cautionary Note Regarding Forward Looking Statements
This press release contains forward-looking statements within the meaning of the Private Securities Litigation Reform Act of 1995, as amended, including, without limitation, implied and express statements about Prime Medicine’s beliefs and expectations regarding: the initiation, timing, progress and results of its research and development programs, preclinical studies and future clinical trials; its ability to demonstrate, and the timing of, preclinical proof-of-concept in vivo for multiple programs; its ability to advance any product candidates that Prime Medicine may identify and successfully complete any clinical studies, including the manufacture of any such
product candidates; its ability to quickly leverage programs within its initial target indications and to progress additional programs to further develop its pipeline; the timing of its regulatory filings, including its investigational new drug applications submissions; the implementation of its strategic plans for its business, programs and technology; and our estimates of our expenses, capital requirements, and needs for additional financing as well as our cash runway into 2025. The words “may,” “might,” “will,” “could,” “would,” “should,” “expect,” “plan,” “anticipate,” “intend,” “believe,” “expect,” “estimate,” “seek,” “predict,” “future,” “project,” “potential,” “continue,” “target” and similar words or expressions are intended to identify forward-looking statements, although not all forward-looking statements contain these identifying words.
Any forward-looking statements in this press release are based on management’s current expectations and beliefs and are subject to a number of risks, uncertainties and important factors that may cause actual events or results to differ materially from those expressed or implied by any forward-looking statements contained in this press release, ,including, without limitation, risks associated with: uncertainties related to the authorization, initiation and conduct of preclinical and other development requirements for potential product candidates, including uncertainties related to regulatory approvals; risks related to the results of preclinical studies or clinical studies not being predictive of future results in connection with future studies; the scope of protection Prime Medicine is able to establish and maintain for intellectual property rights covering its Prime Editing technology; Prime Medicine’s ability to identify and enter into future license agreements and collaborations; and general economic, industry and market conditions, including rising interest rates and inflation. These and other risks and uncertainties are described in greater detail in the section entitled “Risk Factors” in Prime Medicine’s most recent Quarterly Report on Form 10-Q, as well as any subsequent filings with the Securities and Exchange Commission. In addition, any forward-looking statements represent Prime Medicine’s views only as of today and should not be relied upon as representing its views as of any subsequent date. Prime Medicine explicitly disclaims any obligation to update any forward-looking statements. No representations or warranties (expressed or implied) are made about the accuracy of any such forward-looking statements.
Investor Contact
Hannah Deresiewicz
Stern Investor Relations, Inc.
212-362-1200
Media Contact
Dan Budwick, 1AB